2017-08-28 08:24:422025-05-19 10:13:26

locus

BSU13990

BSU_13990

geneLength

1818

1821

outlinks

bsu

BSU13990

BSU_13990

The protein

Catalyzed reaction/ biological activity

autophosphorylation, phosphorylation of [[protein|Spo0F]]

mainly active in the older, inner regions of a colony (with [[protein|KinB]]) [Pubmed|21097618]

autophosphorylation, phosphorylation of [[protein|Spo0F]]

mainly active in the older, inner regions of a colony (with [[protein|KinB]]) [Pubmed|21097618]

ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

The protein

[SW|Domains]

three tandem [SW|PAS domain]s in the N-terminal region of KinA, the [SW|second PAS] domain is the major N-terminal determinant of KinA dimerization [Pubmed|23504013]

the first [SW|PAS domain] is required for NAD(⁺) binding [Pubmed|23599347]

C-terminal histidine phosphotransferase domain

three tandem [SW|PAS domain]s in the N-terminal region of KinA, the [SW|second PAS] domain is the major N-terminal determinant of KinA dimerization [Pubmed|23504013]

the first [SW|PAS domain] is required for NAD(⁺) binding [Pubmed|23599347]

3 [SW|PAS domain]s (aa 3-73, aa 140-214, aa 265-335) (according to UniProt)

2 [SW|PAC domain]s (aa 77-116, aa 218-255) (according to UniProt)

[SW|Histidine Kinase domain] (aa 402-606) (according to UniProt)

References

Original Publications

23169620, 20511506, 19561131, 20413551, 1846779, 11292798, 16166384, 11734624, 9299348, 12067336, 18174125, 10094672, 11069677, 15023339, 2509430, 17350039, 9334321, 9477965, 9644251, 1569009, 20081035, 21097618, 21926229, 22303282, 22670053, 23335417, 23378509, 23504013, 23599347, 25598361, 26055117, 26165942, 26657919, 26712348, 27216630, 28449380, 18324779

32560401, 23169620, 20511506, 19561131, 20413551, 1846779, 11292798, 16166384, 11734624, 9299348, 12067336, 18174125, 10094672, 11069677, 15023339, 2509430, 17350039, 9334321, 9477965, 9644251, 1569009, 20081035, 21097618, 21926229, 22303282, 22670053, 23335417, 23378509, 23504013, 23599347, 25598361, 26055117, 26165942, 26657919, 26712348, 27216630, 28449380, 18324779, 28838935

The protein

Paralogous protein(s)

[[this]]

Biological materials

Mutant

BKE13990 (Δ[[gene|kinA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTTTGCA, downstream forward: _UP4_TTTCCAAAAAAATAAAAACA

BKK13990 (Δ[[gene|kinA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTTTGCA, downstream forward: _UP4_TTTCCAAAAAAATAAAAACA